What is a K-Mer in sequencing?

Usually, the term k-mer refers to all of a sequence’s subsequences of length , such that the sequence AGAT would have four monomers (A, G, A, and T), three 2-mers (AG, GA, AT), two 3-mers (AGA and GAT) and one 4-mer (AGAT). More generally, a sequence of length will have k-mers and total possible k-mers, where.

How do you calculate k-mers?

k-mer counting involves counting the number of substrings that have length k in a string S, or a set of strings, where k is a positive integer. Let ∑ = {A, C, G, T, N} denote the alphabet of DNA nucleotide sequences, where N denotes an undetermined character. A read r is a sequence of nucleotides over the alphabet ∑.

What is K-Mer value?

k-mer can indicate low quality or contamination in your sequences. Usually you compute it by checking if there is a string of length k that occurs in the reads more than chance. Tools like Fastqc can also give you a visual representation to that and to what kind of sequence you see.

What is K-mer frequency?

A K-mer spectra is a graphical representation of a dataset showing how many short fixed length words (k-mers) appear a certain number of times. The frequency of occurance is plotted on the x-axis and the number of k-mers on the y-axis.

What is a k-mer and why is it so influential in transcriptome assembly?

Several pipelines for the assembly of transcriptomes have been suggested in a number of studies. These studies have identified k-mer size as an important parameter. Thus, the length of the chosen k-mer influences the connectivity between the nodes and can affect the result of the assembly considerably.

What is the expected number of occurrences of a k-mer in this sequence?

so the expected number of occurrences of that k-mer is N/4^k, 10kb / 4 ^ 7 = 0.6103516.

What is the best k-mer value?

Also, the best k-mer length was 61, and this should be the k-mer size when running an assembler such as Velvet, SOAPdenovo 2, ABySS, or Minia. KmerGenie outputs some great plots which show why k=61 was the choice.

What is k-mer distribution analysis?

The k-mer frequency follows a pseudo-normal distribution (actually it is a Poisson distribution) around the mean coverage in histogram of k-mer counts. Once the k-mer frequencies are calculated a histogram is plotted to visualize the distribution and to calculate mean coverage.

What is the most frequent 3-Mer?

For example, “ACTAT” is a most frequent 5-mer in “ACAACTATGCATCACTATCGGGAACTATCCT”, and “ATA” is a most frequent 3-mer of “CGATATATCCATAG”.

What is the most frequent 3 Mer?

What is the k-mer value for the distance matrix?

integer representing the k-mer size to be used for calculating the distance matrix. Defaults to 5. Note that high values of k may be slow to compute and use a lot of memory due to the large numbers of calculations required, particularly when the residue alphabet is also large. a character string giving the k-mer distance measure to be used.

How do you find the k-mer sparse matrix for a sequence?

The k -mer sparse matrix M for the sequence s is a 4 k by L − k + 1 matrix, which can be obtained by using a sliding window of length k, shifting the frame one letter each time from position 1 to L − k + 1, until the entire sequence has been scanned.

What are the options for k-mer distance measurement?

a character string giving the k-mer distance measure to be used. Currently the available options are “edgar” (default; see Edgar (2004) for details) and the standard methods available for the base function “dist” (“euclidean”, “maximum”, “manhattan”, “canberra”, “binary” and “minkowski”).

How does K-distance work?

The kdistance function can then compute an alignment-free distance matrix, using a matrix of k -mer counts to derive the pairwise distances. The default distance metric used by kdistance is the k -mer ( k -tuple) distance measure outlined in Edgar (2004).